                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:133 nt.     Distance to run of Ts=3 nt.   Size=36 nt.     Delta G=-19.50 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-10.90 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-23.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGATCGTGTCACTTGGCTCGAATGTCAGCACGTTGCGGCAGACGGAGAGCGCGATCGG
TGATGCGGAGGCGCTTCGATCCCGGCTGATCGGCAGGATCGACCTGCGCGTGGTTGCC
GATGCGCCGATGAAGCTGGTGTGAcgcgccggccgttcggcacctttgttcactgccccagcttcgcccgtcccttgcatcg
ctgccagtggcttccggcgcgaaatcggctgtctctggccgcttgcaattgccttctggtggcctaccatgaaaagcgttgggaccttgaaggagtgcag
ccATG

    bll5354 Gene: bll5354     GI: 27380465     BI number: bll5354     GOG: COG1839     Description: AT G  C TG CG        GA GC       C  T G  A       CG C  |       GC CG       T  | CG        TG         A TA        GC       G  c AT        GC       T  g GC        TG        Gc CG       |  A       Tg TA       |  T       Gc T  |      G  G       Gc C  |      C  A       Tg G  |      G  A       Cg C  |       CG        Gc GC        GC       A  c GC       T  T      A  g AT        CG       G  t G  G       CG       T  | GC        AT        At CG       |  G       Gc GC        GT        Cg TG        CG        Cg AT        TA        Gc                         acctttgttcactgccccagcttcgcccgtcccttgcatcgctgccagtggcttccggcgcgaaatcggctgtctctggccgcttgcaattgccttctggtggcctaccatgaaaagcgttgggaccttgaaggagtgcagccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1839 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................