                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:123 nt.     Distance to run of Ts=1 nt.   Size=36 nt.     Delta G=-25.80 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -6.30 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G=-14.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCGCGATGAAGCGCGACAAGCTGATCCTGGACGAGCGCGAGAAGCAGGCGGCCGTCG
TGTCGCCGGCGCCGGAAGCGGAGCTTCCTGCGCTGCCGCCTGCGGAATGAtcgttcatccgta
ggaataccgaggacaatgaaaaggccggcgcaagccggcctttttgctgctttgtttccctgttgcggtgcaggatcaacctttgttcatctttccttca
ggcgtaaaagcgcttctgctaggggagtttagaccggtggtcccgtgacgggggcagggccggagaccacggaactcacATG

    bll5408 Gene: bll5408     GI: 27380519     BI number: bll5408     GOG: COG1232     Description:                      ca            at       g  a           a  a       cg            gc        gc cg        gc        gc t  t      a  g       cg At       t  a       cg Gc       g  |       gc Ta        cg        gc A  |       cg        at At        ta        at Gc       a  c       at Gc       c  |       at Cg        ta        gt Gt        ta       t  g Ta        gt       a  c Cg        cg        at Cg        ta        cg                         ctttgtttccctgttgcggtgcaggatcaacctttgttcatctttccttcaggcgtaaaagcgcttctgctaggggagtttagaccggtggtcccgtgacgggggcagggccggagaccacggaactcacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG1232 Protoporphyrinogen oxidase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_japonicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:135 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-18.70 kcal/mol Antiterminator: Size=67 nt.     Delta G=-27.40 kcal/mol Anti-antiterminator:   Size=55 nt.     Delta G=-26.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GTCGCGATGAAGCGCGACAAGCTGATCCTGGACGAGCGCGAGAAGCAGGCGGCCGTCG TGTCGCCGGCGCCGGAAGCGGAGCTTCCTGCGCTGCCGCCTGCGGAATGAtcgttcatccgta ggaataccgaggacaatgaaaaggccggcgcaagccggcctttttgctgctttgtttccctgttgcggtgcaggatcaacctttgttcatctttccttca ggcgtaaaagcgcttctgctaggggagtttagaccggtggtcccgtgacgggggcagggccggagaccacggaactcacATG     bll5408 Gene: bll5408     GI: 27380519     BI number: bll5408     GOG: COG1232     Description:            cg           t  t            At            Gc            Ta           A  |            At            Gc            Gc            Cg            Gt            Ta            Cg   G        Cg G  A      |  a CG       |  a GC       |  t AT       |  a AT       |  c GC       |  c GC       |  g C  T      |  a CG       |  g GC       |  g CG       |  a GC       |  c GT       |  a CG       |  a |  C      |  t |  C      |  g |  G      |  a |  C      |  a |  C      |  a |  T      G  a CG        Cg GC        Cg        ca CG       |  c      g  a T  G       Gc        cg G  A       Tg        gc TA        Cg        gc GT        Gc        cg CG        Cg        cg TA        Gc        gc Gt        Ta        gc                         tttttgctgctttgtttccctgttgcggtgcaggatcaacctttgttcatctttccttcaggcgtaaaagcgcttctgctaggggagtttagaccggtggtcccgtgacgggggcagggccggagaccacggaactcacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG1232 Protoporphyrinogen oxidase ... can be seen here     ..................................................................................................................