                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:65 nt.     Distance to run of Ts=2 nt.   Size=34 nt.     Delta G= -9.20 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-23.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCGCTCGCCGGCTTCCGTCGGTGCGACGCTGCGGGTGGTGCGGGTGAGCAGCCGCAG
GCCGAGCCGCTCCTCCAGCGCGCGCACGGTGTGGCTGAGCGCGGATTGCGACACGCCG
AGCTGGGCGGCCGCGCGGGTGAAGCTGCGCTCGCGGGCGACCGCGAGGAAGGCGAGGA
GGTCGTTGACGTTGGTGCGGGCCATtcatgaatccggatcatgagtacatgccggttttatcacctaatcgcaggctcgcgc
gcgacctaaattcgcagccgaacgtgatttcaaggagagctgcgATG

    bll5547 Gene: bll5547     GI: 27380658     BI number: bll5547     GOG: COG0667     Description: aldo-keto reductas   A G  A G  G A  G GC CG |  A |  G |  G G  A       CG CG       G  G CG        TG         c AT        GC       c  g GC        GC       t  g CG        TA       a  a GT       T  T       at |  T      G  |       gc |  G      C  |       ta G  A       At        at GC        Gc        cg CG       T  |       ta GT        Ta        Tg C  T       Gt        At TG        Cg       |  a CG        Ta       |  c GT       G  a      |  a CG       G  |      C  t GC        At        Cg TG        Gc        Gc CG        Gc        Gc                         ggttttatcacctaatcgcaggctcgcgcgcgacctaaattcgcagccgaacgtgatttcaaggagagctgcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0667 Predicted oxidoreductases (related to aryl-alcohol dehydrogenases) ... can be seen here     ..................................................................................................................