                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:82 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-11.20 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-12.50 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-11.81 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTTCGCCGGCACCGGCGTGGGGCGAGATCTTCTTCGATGACGTCTTTGCCATgagtccaa
acttacccgcagcgacgccgcatcagcaagccgcatctgttccgcgctgaaaagattcgcaaagcgcaacccatctgcatcgcctttgggcatggggcgg
ctgatcaatccgcaggcagcgccggctaagcggctccaatgcttcgccttttgtttttggccgcctctggcacgctccatgcaaggaaacagaccgttcg
gtatcctgccgatttcctcggctgccagggagaaaactgATG

    bll5738 --- bll5737 Gene: bll5738     GI: 27380849     BI number: bll5738     GOG: COG1765     Description: - Gene: bll5737     GI: 27380848     BI number: bll5737     GOG: COG1960     Description:             t tt       a  c t  g      g  a cg       t  a cg       c  t       ta gc        gc       c  a c  |       gc       g  g t  |       cg        gc a  |       gc        cg c  |      |  a       cg g  |      g  g       gc t  |      g  g      |  t c  |       gc       |  c ta        ta       |  c at       |  g      |  a cg       a  c      |  a cg        cg       |  t cg        gc        cg a  |       gc        gc a  |      g  |       at cg       t  |      |  t gc       t  |      |  c |  g      t  |       cg cg        cg        gc gc        cg        gc at        gc        at                         tttgtttttggccgcctctggcacgctccatgcaaggaaacagaccgttcggtatcctgccgatttcctcggctgccagggagaaaactgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG1765 Predicted redox protein, regulator of disulfide bond formation ... can be seen here [I] COG1960 Acyl-CoA dehydrogenases ... can be seen here     ..................................................................................................................