                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:67 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-11.60 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-10.50 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-15.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGAGCGGCGTTCGGTGCGGCAAGATTAGGGCGTCTTGCTGTCACGGGTGAGGCAATCG
ACGCCGTCTGTACGCCGCCGCGACGCATCGAGACGTTCGAGCCTGATCGCGTGCTCGT
CGATGCCTATGCCGATCGGCTTCCCGCCTGGCGCGAACTGTATCGGCCACGCCGCTAG
cgccgtttcgatttcgctttcccgtcggttcggtattgccctgtgccgcggcgttttgtttaatgcgcgaaccgcgctgagaaaacgagacgcgggtggg
aaacgcattgtgcgtcgggaggcacgATG

    bll5784 --- bll5783 --- bll5782 Gene: bll5784     GI: 27380895     BI number: bll5784     GOG: COG1129     Description: ABC transporter ATP-binding protein Gene: bll5783     GI: 27380894     BI number: bll5783     GOG: COG4158     Description: ABC transporter permease protein Gene: bll5782     GI: 27380893     BI number: bll5782     GOG: COG1879     Description: ABC transporter sugar-binding protei TG C  T A  A        t AT       c  t GC       g  t CG       c  c G  |      t  c CG       t  c GC        tg        cc GC        at       g  c TA        gc       t  t C  C       cg        tg CG        tg        at GC       t  t       tg |  C      t  t       gc |  G       gc        gc C  C       cg        cg C  T       cg       t  | C  A      g  t      t  | T  G      c  a      g  | T  c       Gt        gc Cg        At        cg Gc       T  |       tg Gc        Cg        gc Cg        Gc        cg                         ttttgtttaatgcgcgaaccgcgctgagaaaacgagacgcgggtgggaaacgcattgtgcgtcgggaggcacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1129 ABC-type sugar transport system, ATPase component ... can be seen here [R] COG4158 Predicted ABC-type sugar transport system, permease component ... can be seen here [G] COG1879 ABC-type sugar transport system, periplasmic component ... can be seen here     ..................................................................................................................