                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:115 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-24.60 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-11.00 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-11.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGACGCTTGACCGCAACACCGGCGCTGTGGTTGCCGGCAGCGAGCAGCCGGGTGAGGT
CACCGAAGTCTGGACCTTCGCCCGACGCCCGGGCGGCACCTGGGAATTGTCGGCGATC
CAGCAGACCAACTGAtcgcgagcgaattgaacaatcagggcgtcgtgcttcggcacggcgcctttttctttgagccgcatttatccccg
atccggccgaccatttgggcgaagcacttaattgcttgttgcccgcgcgctgctcccgcaatttcgcgcctgccggtcagcgaaggagatattcgGTG

    bll5806 Gene: bll5806     GI: 27380917     BI number: bll5806     GOG: COG0154     Description: GA C  T GC GC        ca C  A      a  a TG        at GC        gc TA        ta TG        tg A  A      a  g A  |      a  g       tc G  |       gc       t  g GC        cg        cg GC       g  |       gc TA        at        ta C  A       gc        gc C  C       cg        cg AT        gt        tg CG        cg        gc |  A      |  c       cg Gt       t  t       gc Gc        At        gc Cg        Gc        gt Gc        Tg        at                         tttctttgagccgcatttatccccgatccggccgaccatttgggcgaagcacttaattgcttgttgcccgcgcgctgctcccgcaatttcgcgcctgccggtcagcgaaggagatattcgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0154 Asp-tRNAAsn/Glu-tRNAGln amidotransferase A subunit and related amidases ... can be seen here     ..................................................................................................................