Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:157 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-24.10 kcal/mol
Antiterminator: Size=59 nt.     Delta G=-20.20 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G=-10.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTCGACCCGCCAGTCGATCGCGGTCTCCGCGCTGTCGCTGGCCAACCAGTCGCAGCA
GAGCGTGCTCCAGCTGCTCCGCTAGtaagtaactgaaataacttggtaaaatagagcggcggggttttgtgccccgccgctt
ttttgcgtccggaggcgggcaggggcgttcattcgccattaaccctatcgcttaaaccggcgttaaccatactttaaaggacacctcctaaaactggacc
aaagcccgctttcgagaccgcgcggccgattcgtatccggttcaagaggaagactcgccaATG

    bll5843


Gene: bll5843     GI: 27380954     BI number: bll5843     GOG: -------     Description:


           ga
          t  a
          c  a
          a  t
          a  a
           ta
           gc
           at
           at
           tg
          G  g
           At
           Ta
          |  a
          |  a
          C  a
          G  t
          C  a        t
 CC        Cg       t  g
T  A       Ta       t  t
 CG        Cg        tg
 GC        Gc        gc
T  |       Tg        gc
 GT        Cg        gc
 CG        Gc        gc
 GC       A  |       cg
 AT        Cg        gc
 GC        Cg        gc
A  C       Tg        cg
 CG        Cg        gc
 GC        Gt        at
                        tttttgcgtccggaggcgggcaggggcgttcattcgccattaaccctatcgcttaaaccggcgttaaccatactttaaaggacacctcctaaaactggaccaaagcccgctttcgagaccgcgcggccgattcgtatccggttcaagaggaagactcgccaATG


    ..................................................................................................................