Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:118 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G=-12.70 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -9.60 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-12.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cagcccttgacaaggataggttctgtgccggaccggcgacttttgtcatatgtggttcacatcggacgcgcgttaagcatatgagtcgccaaaccggcca
ggcccgcgcgttcgtatattggcatgctttcatatcgtgccgtccgcggcattgttccagcgcaagcgatgccggcttttttggaacgtcgatgccgcgt
gcccgttagcgccccatcagcaatcgaacatggcgggaatatgcggctattcgtgcgagccggtgcctccgtgttcccgaaacccaagaggatcggaacg
ATG

    bll5866


Gene: bll5866     GI: 27380977     BI number: bll5866     GOG: COG3685     Description:


  a
c  g
 cg
 gc
 gc
c  c
c  g
a  c
a  |
a  |        c
c  |      t  a
 cg       t  t
 gc       t  a
 cg       c  t
t  |       gc
 gt        tg        gc
 at        at       a  g
 gc        cg       c  c
 tg        gc       c  a
 at        gc        ta
 ta        tg        tg
 at       t  t       gc
c  a      a  c       tg
g  |      t  c       ta
 at       a  |       at
 at        tg        cg
 tg        gc        gc
 tg        cg        gc
 gc        tg        cg
                        gcttttttggaacgtcgatgccgcgtgcccgttagcgccccatcagcaatcgaacatggcgggaatatgcggctattcgtgcgagccggtgcctccgtgttcccgaaacccaagaggatcggaacgATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG3685 Uncharacterized protein conserved in bacteria ... can be seen here

    ..................................................................................................................