                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:105 nt.     Distance to run of Ts=2 nt.   Size=16 nt.     Delta G= -7.60 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-20.60 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-23.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGGTTGCGAGAGCCTGTCGCAGGACGTCATCAGCCTGCCGATGCACGCCTACCTGAC
CGAAGCCGACCAGGAGCGAATCATCGCCGCCGTGCGCGGGGCGATTGCGGGTTGAtctt
ggttcacctctcccgctcgcgggagaggtcggcgcgaagcgccgggtgagggttctctcctctgggggagtctttcttgttgagacaccctctccccaac
cctgccccgcgagcgggggagggagcagaccgtccccgcggtttgcacctagacctgatctcgccatgctctaaaacagacgcATG

    bll5916 Gene: bll5916     GI: 27381027     BI number: bll5916     GOG: COG0728     Description: tc c  g        a gc       g  a cg        cg cg        gc cg        cg ta        gc cg        gc ta        cg cg        tg cg       |  g a  |      |  t c  |      |  g t  |      |  a t  |      |  g g  |      |  g g  |      |  g t  |      |  t t  |       gt c  |       gc t  |       at At        gc        ct Gc        at       t  g Tg        gc        cg Tg        gc        cg Gc        gt        tg G  g      c  c       cg Gc        gt        ta Cg        cg        cg                         tctttcttgttgagacaccctctccccaaccctgccccgcgagcgggggagggagcagaccgtccccgcggtttgcacctagacctgatctcgccatgctctaaaacagacgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0728 Uncharacterized membrane protein, putative virulence factor ... can be seen here     ..................................................................................................................