                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:46 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-28.40 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-27.80 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-15.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGGCGGCGCAGGCGATGGATCTCACGCCCCGCGGCATCCGCAGCCATCTCGACCTCA
ACCGCCCGATCTACGCGCGCACCTCGGCCTACGGCCATTTCGGCCGCACGCCCGACAA
CGAGGGCGGCTTCTCCTGGGAGAAGACCGATCTCGTCGAGCAGCTGAAGCGCGCGCTC
TAGttcacttgcgtcattccggggcgccgcgacagcggcgaacccggaatctcgatcctccggattccgggttcgctcttttcgcgagcgccccggaa
tgacgagtcaaacaaacaggaaccccctATG

    ahcY Gene: ahcY     GI: 27381055     BI number: bll5944     GOG: COG0499     Description: S-adenosylhomocysteine hydrolas tg t  c cg at        ac |  c      g  a c  a       cg        cc t  t       gc       t  t t  t       cg       a  c G  c       cg        gc A  c       gc        cg Tg        cg       t  | Cg       |  a       cg Tg       g  a       ta Cg        gc        at Gc        gc        at Cg        gc        gc Gc        cg        gc C  |       cg        cg Gc        ta        cg Cg        ta        cg Gc        at        at A  g      c  c       at A  a      t  t       gc Gc        gc        cg Ta        cg        gc                         tcttttcgcgagcgccccggaatgacgagtcaaacaaacaggaaccccctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0499 S-adenosylhomocysteine hydrolase ... can be seen here     ..................................................................................................................