                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=3 nt.   Size=27 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-11.70 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTTTGGATCGGCCTCGATCGACTGGTCGGCGGTGACGATGCAGGCGCCGAGCAGGAA
GGAGGCCGATAGTAGGATGAGCGTTCCGGGCAACGCTGAGCGGAGGCGCAAGAGCGGC
TGGACCACCTCGAACAAAATACGCCTGCCAACGCTGGAAGTGATTGAAAATTGCATcc
gatccccctcggttcggacgcgcaatagtttgcgccacgattatgtttttgctaagaaataagtcaagggcaaagggccttccttaaccgccgaagttgt
tgcattcaggtaacaaggtcaacgctGTG

    bll6021 Gene: bll6021     GI: 27381132     BI number: bll6021     GOG: COG2804     Description: general secretion pathway protein             c           c  t           c  c            cg            cg           t  t       ag   A        at       t  t G  A       gc        at TA        cg        at TA        cg        cg AT        Ta        gc GT       |  c       cg TG       |  g       gc GC       A  c      c  c A  A       Cg       a  a AT        Gc       g  | Gc        Ta        gc Gc        Ta        cg Tg        At        ta                         ttatgtttttgctaagaaataagtcaagggcaaagggccttccttaaccgccgaagttgttgcattcaggtaacaaggtcaacgctGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NU] COG2804 Type II secretory pathway, ATPase PulE/Tfp pilus assembly pathway, ATPase PilB ... can be seen here     ..................................................................................................................