                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-25.30 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -7.20 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-12.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGAGAACCTGAGCACGGGCTTCGCCCTGGGCGGTGCCGCCTCGGCGCGCATCGGCCG
GTCGATGATCGTCAATAATCTGGGATCGGCGACCACCGGCAGCGTGCTGTCGTATCTG
GACAACCAGATCAACGGCAACGCCCCGGACACGACTCCGGCGACAGCAGGCGGATATC
ACTAGcctcatgcaattgatcagctccgggcgccaagcgcccggagcttttttgcgcccggctcccactatggatttcgccacgtccgcagactagt
ctggctgcgcagcagggagagcgggcgggATG

    bll6024 Gene: bll6024     GI: 27381135     BI number: bll6024     GOG: COG0790     Description: CG A  A C  C AT GC GC CG CG |  C       ca |  G      g  a |  A      t  t |  C       at |  A       cg |  G       ta |  C      |  t |  A      |  c CG       c  a CG        cg GC        Gc CG        At         a |  G      T  c      c  a |  A      C  c       cg |  T      A  g       gc |  A       Cg        cg |  T       Tg        gc |  C      A  |       gc |  A      T  |       gc |  C      A  |       cg A  T      G  |       cg A  A       Gc        ta CG        Cg        cg Gc        Gc        gc Gc        Gc        at                         tttttgcgcccggctcccactatggatttcgccacgtccgcagactagtctggctgcgcagcagggagagcgggcgggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0790 FOG: TPR repeat, SEL1 subfamily ... can be seen here     ..................................................................................................................