                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:16 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-26.60 kcal/mol
Antiterminator: Size=23 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-18.91 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCGCATTGGATGGGACAGCATCGTCTCGGACACAACGGACAATCCGGTATCCGCCA
ATAATTTCATCCAGGCTGGCTATCGGCTCTATGAGCCCGAGGTACCCTGGGCCTGGTC
GCATACGCTTTACTGGCGAAAACGGCTGCGCTGAgttggggagccggtgtttcccgtgatgcggaacgcggcgtt
cgcggcgtagaactgggcgcgcgagacgcggtgcaggcctgcacgcccataatgtcgagaggcccggcagcttgacagctgccgggccctttttgcgttt
tcagacgatGTG

    bll6097 Gene: bll6097     GI: 27381208     BI number: bll6097     GOG: COG1804     Description: gc g  c at cg gc ta g  | gc cg gc |  c |  c |  a |  t |  a |  a |  t cg at                  ga gc                 t  c a  g        c        ta g  a      c  g       cg c  g       cg        gc g  a       gc        at c  g      g  a       cg g  |      a  g       gc cg        gc        gc gc        at        cg gc        gt        cg gc        cg        cg tg        ta        gc cg        gc        gc                         ctttttgcgttttcagacgatGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1804 Predicted acyl-CoA transferases/carnitine dehydratase ... can be seen here     ..................................................................................................................