Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:101 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-19.70 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -4.76 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -8.37 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cactggcagaatgccatcatcgaaacgagtttggttcggcccgcgcgggacaatccgcggcgggctttttcatgtccacctggtgtgacgacaatttcgt
tcaacacaggatttgactcgtcgggcaagacaccggcagaatgacatcatcgagacgagtttgattgacccgcgcggagagcatccgccgcgggtttttt
cgttctcgatcggaatcggacggcggcaacgcattgcggccacgcactcgacaaacctggagcgccgatcggcgcgccgtcgtccgaaccattgctggcc
GTG

    bll6102 --- bsl6101


Gene: bll6102     GI: 27381213     BI number: bll6102     GOG: -------     Description: -
Gene: bsl6101     GI: 27381212     BI number: bsl6101     GOG: -------     Description:


 ag
a  a
c  c
g  a
 gc
 gc
 cg
 tg
 gc         g
c  a      a  a
t  |       gc
c  |       cg
a  |       ta
g  |      a  g
t  |      c  t
t  |      t  t
t  |       at
a  |       cg         g
g  |      |  a      a  c
g  |      a  t      g  a
a  |      g  t       at
c  |      t  g       gc
a  |      a  a       gc
c  |      a  c       cg
a  |      g  c      |  c
a  |      a  c       gc
 cg        cg        cg
 ta        gc        gc
 ta       |  g       cg
 gt        gc        cg
 cg        cg        cg
 ta        cg        at
                        tttttcgttctcgatcggaatcggacggcggcaacgcattgcggccacgcactcgacaaacctggagcgccgatcggcgcgccgtcgtccgaaccattgctggccGTG


    ..................................................................................................................