                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:77 nt.     Distance to run of Ts=3 nt.   Size=35 nt.     Delta G=-12.90 kcal/mol
Antiterminator: Size=26 nt.     Delta G= -5.90 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGTTCCTTGATAACGCCCCAGCAGTTTCACGGCAGGCAAAGACCTTAAGATATGGGC
ATTAGAACGCATgcattaaacatctcttatcatgtaatttgctaagaaccaaccacttcgggtgccgttgatagtatttcccgtattcttc
gatagaaattcgacacaggtttctggccgcaagccggttcaagccagcgagaactggcggtgatatattttgtatctagattgatgcttgaagcggtaat
ttgcatggtgtaaatatattcgatgagaaatttgccgaaggccgccatttcATG

    bll6346 Gene: bll6346     GI: 27381457     BI number: bll6346     GOG: COG1396     Description:                      ca                     c  g   c                 g  c a  a        c       a  g g  c      g  a      a  a c  a      c  a       cg tg        cg        ta tg        gc        ta at        gc        gc at        tg        gt at        cg        cg gc       |  t       cg at       |  t       gc tg       |  c      a  g |  g       ta       a  | a  c       ta        cg gc        tg        gt cg        gc        cg                         atatattttgtatctagattgatgcttgaagcggtaatttgcatggtgtaaatatattcgatgagaaatttgccgaaggccgccatttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1396 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................