                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:109 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-20.90 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-17.30 kcal/mol
Anti-antiterminator:   Size=14 nt.     Delta G= -6.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTCCTACGCGCGCTATGACAGCGGCGGCCCCGCCTGGTACGGCAACTGGGACGCCTA
CGCAGCCCGCAACGGCATCGTGTGCAGACCCGGCACATGGTTCAAGGGCGAAGACGGA
CGGCGGCACCTCTGCCAGTAAggccccggccatcaggctgaaagcttgcaggcggcccgacgggccgcctgtttcttgccggcga
aacgccactgccaggttctggcactttccgaccaagtctgatattgcgacgcccgagcgggcggacagctccggcacatgccgagccctgccccgcgtcG
CC

    _v40 Gene: _v40     GI: _v40     BI number: _v40     GOG: -------     Description:             a           g  a           t  a            cg            gc            gt            at            cg           t  c           a  a            cg            cg            gc         a           g  |      g  c           c  |       cg           c  |       cg            cg        cg tc        cg        gc a  a       gc        gc cg        gc        cg cg       A  c       gc gc       A  g       gc gt        Ta        at cg        Gc        cg                         tttcttgccggcgaaacgccactgccaggttctggcactttccgaccaagtctgatattgcgacgcccgagcgggcggacagctccggcacatgccgagccctgccccgcgtcGCC     ..................................................................................................................