                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:101 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-20.80 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-13.20 kcal/mol
Anti-antiterminator:   Size=15 nt.     Delta G= -7.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAGGACGGCCCGCCCCGCCACTTCATGGAACGCGGCATGGACCGCATGATGGAGCGC
GGCATGGACCACTTCCATGGCGACCGTTTCGACCGTGACGGCGGCCCGGACCGGGATC
GCGAGGGCCGGCTCTGAgcaaacctggactttccagggattaaccttggcgaagccgctggaatccagcggcttttcgctttcttggg
cctgtggaagaaccttggaaaacatgcgccacatcgcttgccagacccggatcgctttgctaaacgaccggcctcgcaaggcattcaccgcctttcGGG

    _v44 Gene: _v44     GI: _v44     BI number: _v44     GOG: -------     Description:             t           t  a           a  a            gc            gc            gt         a            at       a  t            cg        gc            cg        gc           |  c       ta            tg        cg            ta        gc            ta        cg            cg        cg   t       a  |       gc c  t       gc        at a  t       gc       |  t gc        tg       |  t gc       |  c       at ta       |  t       gc cg        cg        cg cg        cg        gc                         tttcttgggcctgtggaagaaccttggaaaacatgcgccacatcgcttgccagacccggatcgctttgctaaacgaccggcctcgcaaggcattcaccgcctttcGGG     ..................................................................................................................