                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:184 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G= -7.50 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-13.10 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -4.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGGGTGACGATCTTCCATTGGAGTTAAGAGCCGAGAATATGCGGCTTGCTTCGCA
ATTCCTTGGACGGATCACGGGCGATGTGGATGTCGAGGAAATTCTGGACGTTATTTTC
TCGCAATTCTGCATCGGGAAGTGAttcacgtgaaacatgcagctttatgagcaccaatagccgttgcaatgtttcacgtgaa
acatctgtggaatcctgtttgttgaattgactcccatcaatgtatgtgagtcgattgtctgaaatggccgaatagaagggcggacatagtttttccttcc
gtTTG

    BMEI0007 --- BMEI0008 --- BMEI0009 Gene: BMEI0007     GI: 17986291     BI number: BMEI0007     GOG: COG0445     Description: GLUCOSE INHIBITED DIVISION PROTEIN A Gene: BMEI0008     GI: 17986292     BI number: BMEI0008     GOG: COG0357     Description: GLUCOSE INHIBITED DIVISION PROTEIN B Gene: BMEI0009     GI: 17986293     BI number: BMEI0009     GOG: COG1192     Description: CHROMOSOME PARTITIONING PROTEIN PAR             C           G  G           G  A            GT            CG            AT GG        CG T  A       TG T  C      A  A CG       G  |       AA CG        GT       A  T TA        CG        GT |  T       AT        GC |  C      G  |       AT |  A       GC       G  G T  C       TG        CG A  G       TA        TA A  G       CG        GC CG        CG        TG GC        TA        AT CG        TA        GT                         ATTTTCTCGCAATTCTGCATCGGGAAGTGAttcacgtgaaacatgcagctttatgagcaccaatagccgttgcaatgtttcacgtgaaacatctgtggaatcctgtttgttgaattgactcccatcaatgtatgtgagtcgattgtctgaaatggccgaatagaagggcggacatagtttttccttccgtTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG0445 NAD/FAD-utilizing enzyme apparently involved in cell division ... can be seen here [M] COG0357 Predicted S-adenosylmethionine-dependent methyltransferase involved in bacterial cell division ... can be seen here [D] COG1192 ATPases involved in chromosome partitioning ... can be seen here     ..................................................................................................................