Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:179 nt.    Distance to gene:15 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -8.90 kcal/mol
Antiterminator:    Distance from promoter:154 nt. Size=33 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGA-TATCCT. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGATTTTCGCCTTCCTTGTATCCTGCTTCGGCCAGCGCATCCTTGACGCCGTCAC
GGGCGGCATCGAGAGCCGGATGTTCGACAATAGCGGTCACGGCGACGGTGACGTCTTT
CGCCTGTGCGGTAGTGGCAATGGCTGCTGCGGCCAGCGAGGCCAGAAGCATggaccgaaact
tgaaacgcatgaaaatctcccctgttttggtgcgttgcttattggcaaacaccttttctccaataacccagaTTG

    BMEI0016 --- BMEI0017


Gene: BMEI0016     GI: 17986300     BI number: BMEI0016     GOG: -------     Description: Hypothetical Protein
Gene: BMEI0017     GI: 17986301     BI number: BMEI0017     GOG: COG2141     Description: ALKANAL MONOOXYGENASE ALPHA CHAI


  c
c  c
t  c
c  t
 tg        at
 at       t  t
 at        tg
 at        cg
 at        gc
g  g       ta
 tg        ta
 at       g  a
 cg       c  |
 gc        gc
 cg        ta
 at        gc
 at        gc
            ttttctccaataacccagaTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG2141 Coenzyme F420-dependent N5,N10-methylene tetrahydromethanopterin reductase and related flavin-dependent oxidoreductases ... can be seen here

    ..................................................................................................................