                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:47 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G=-11.80 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-19.00 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-18.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTTTCGCGCCGCCAGAACCGTCCCCTTTTGAGAAACAGCGATCCGCGCGGCGTCATG
CAGCGGCTGATGGACGAGCGCTACCCGGTTTATGCGCTGGCCGAGCTGCATCTGATGA
CGCGCGATGAGAAAAAGGAAGTGATTGCCGCAGAACTGATCGAGGTTCTGGCGGCGCA
TCTGGAAAAGGAACAGGCCGCTTCCGCCGGATGAcggccgaaacctgaagcggtccacgggccgttttctttatt
tgtttcgtgtgtccggtctttcgtccaccggataccagcaggagctgaccaATG

    BMEI0043 Gene: BMEI0043     GI: 17986327     BI number: BMEI0043     GOG: COG0337     Description: 3-DEHYDROQUINATE SYNTHAS             T   A       A  G A  G      G  A A  G       Gc A  A       Cg G  A       Cg GC        Gc TA       |  c CG       |  g TG       |  a |  C      |  a A  C      |  a CG       |  c GC       |  c       ac |  T      C  t      c  g C  T       Cg        cg GC        Ta        tg GC        Ta        gc CG        Cg        gc GC        Gc        cg GC        Cg        gt TG        Cg        at CG        Gt        at TA        Gc        gt                         ctttatttgtttcgtgtgtccggtctttcgtccaccggataccagcaggagctgaccaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0337 3-dehydroquinate synthetase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_melitensis_I                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:56 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-12.90 kcal/mol Antiterminator: Size=38 nt.     Delta G=-13.80 kcal/mol Anti-antiterminator:   Size=24 nt.     Delta G= -5.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGTTTCGCGCCGCCAGAACCGTCCCCTTTTGAGAAACAGCGATCCGCGCGGCGTCATG CAGCGGCTGATGGACGAGCGCTACCCGGTTTATGCGCTGGCCGAGCTGCATCTGATGA CGCGCGATGAGAAAAAGGAAGTGATTGCCGCAGAACTGATCGAGGTTCTGGCGGCGCA TCTGGAAAAGGAACAGGCCGCTTCCGCCGGATGAcggccgaaacctgaagcggtccacgggccgttttctttatt tgtttcgtgtgtccggtctttcgtccaccggataccagcaggagctgaccaATG     BMEI0043 Gene: BMEI0043     GI: 17986327     BI number: BMEI0043     GOG: COG0337     Description: 3-DEHYDROQUINATE SYNTHAS             C           G  C            CG        aa            CG       g  g            TA       t  c           |  T       cg           T  G       cg           C  A       at CA        Gc       |  c A  G       Cg       |  c A  G       Cg       a  a GC        Gc       a  c GC        Gc       g  g A  G      A  g       cg A  C      C  a       cg AT       A  a       gc AT       A  a       gc GC        Gc        cg GC        Gc        At TG        At        Gt                         ttctttatttgtttcgtgtgtccggtctttcgtccaccggataccagcaggagctgaccaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0337 3-dehydroquinate synthetase ... can be seen here     ..................................................................................................................