                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-13.90 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-10.14 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCGTCGCCGTTTCCTGCCGAACCTCTGCAATGTTACGCTGATCTCCGAAACGCTCGG
CCAGAGCTATCGCCTGCGCATTTCCGCCAACGCCCTGCGTTCGGTCGAACATCGCGGT
GGCCTCGATGCCTTCCTCGTCAAATCCGACGATAAGGAACTTTCGCAGCGCGCCCGCC
TGCTCAAGCGCCAGATCGCAAAGAAGCAGGCTGAAGCTGCCGCTTAAgcctacggccttacagtt
tgacaaaaaaggccggcactcgtcggccttttttgctggttccatcacccaggataaaaaaATG

    BMEI0057 Gene: BMEI0057     GI: 17986341     BI number: BMEI0057     GOG: COG1738     Description: Hypothetical Membrane Spanning Protei            tg           t  a GC       t  c T  C      g  a CG       a  a GC       c  a AT       a  a AT        ta G  A       ta TA        cg        ct Cg        cg       a  c Gc        gc        cg Gc        gc        gt At       c  |       gc |  a      a  |       cg |  c      t  |       cg |  g       cg        gc Cg        cg        gc Gc        gc        at                         tttttgctggttccatcacccaggataaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1738 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................