                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:97 nt.     Distance to run of Ts=2 nt.   Size=29 nt.     Delta G=-11.60 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -9.40 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-20.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCACCAATAATTACCATATACCGCGCAGCATTCTGGAAATGTCGTCGCGCATGAAGGA
TGTGGAGTTCATTCCCTATCCGGTGGTGAATGGGGAAAAGCGCGAGCAGAGCTGGGTT
GCCGAAGGTGATACGCTGCGTGTGCTCTTCACCGAATATGTCAAATATCTGGGCGCCG
TTGTTCGGCTTGGCAGCGCCTCGTTTTATGGCAATGGCGCTTCTCATGGCGGCGATAT
GCGCGAATAAagcagtgtgacggcgcatattttccgtatggaaaaccgccgtcttcctgatatatcggGTG

    BMEI0075 Gene: BMEI0075     GI: 17986359     BI number: BMEI0075     GOG: COG0204     Description: 1-ACYL-SN-GLYCEROL-3-PHOSPHATE ACYLTRANSFERAS   A G  A CG CG G  T T  G TA GT G  A G  C T  G C  |        T G  |      A  G A  |      T  T GC       A  C AT       A  A CG       G  A GC       C  A A  G      C  T        G GT       A  A      C  G CG       C  T      T  C GT       T  C      T  T CG       T  T       GT GC        CG        TG A  |       TG        TG A  |       CG        GC A  |       GC       C  A AT        TG        CG GC        GC        GC GT       T  |       CG GT        GC        GC GC        CG        GC TA        GT        GT                         CGTTTTATGGCAATGGCGCTTCTCATGGCGGCGATATGCGCGAATAAagcagtgtgacggcgcatattttccgtatggaaaaccgccgtcttcctgatatatcggGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0204 1-acyl-sn-glycerol-3-phosphate acyltransferase ... can be seen here     ..................................................................................................................