                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -8.80 kcal/mol
Antiterminator: Size=23 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -5.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGGCTGCCGAAGGAAGAATTCCTGCGTCGCCTGATCGAATCCACCGAAACGGTCTGC
GACGAATTTCTCGTGGCTGCAAGCCGCGACCCCAATCCGCCTCCCATGCCGCCAACCG
CCGTTCAAAGGCTGAAGGAACTGGGCGTGTGAtccttgccgaaagttcatgagccgatcgcggtcatccgatcacg
ttcaattgcgttgcgagaacgacaattcgccgcgttttcttgaactttcgtttttcttgcacccgaacctgaaacccgttatcagagcgcgacacgaaag
gacacatcATG

    BMEI0076 Gene: BMEI0076     GI: 17986360     BI number: BMEI0076     GOG: COG0221     Description: INORGANIC PYROPHOSPHATAS                      ga             t       c  c tc       g  t      a  a a  c       cg       a  a cg        gc        gt ta        tg        at gt        ta        gc gc       a  |       cg c  a      a  |       gc gc        cg       t  c cg        ta        tg t  t       ta        gc at        gc        cg gc        cg        gt                         tttcttgaactttcgtttttcttgcacccgaacctgaaacccgttatcagagcgcgacacgaaaggacacatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0221 Inorganic pyrophosphatase ... can be seen here     ..................................................................................................................