                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=1 nt.   Size=18 nt.     Delta G= -8.40 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-18.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cctcgcctttgccatgatgcgtgttatcttgttgcgggataaaaatgcgatacacgccagaaaggccagatgacggatcatagcaacgacaggaaagaca
ggccgcgcgccgcgcggggcgcctttctgcggcttttttccggggaaggcgctgctctgcgccggctacatctgcgcacctttctctccatcgccatcga
gcggctctggccgctcgtgctgccgctgattctgcttcttgcgctgtttgcaagcctgggctggcttggtctttttgcgctgatgccacgctggctgcat
ATG

    BMEI0083 Gene: BMEI0083     GI: 17986367     BI number: BMEI0083     GOG: NOG14524     Description: Hypothetical Protei ct t  g        c cg       t  t gc       t  t gc        cg cg        gc gc        tg at       c  c gc       t  t cg        tg |  t       at |  g       gt t  c      t  t       gg at        cg       g  c cg        gc       t  t c  c      c  a       cg gc       c  |       cg cg       g  |       gc t  c       ta        at at        cg        at cg        gc        cg                         gtctttttgcgctgatgccacgctggctgcatATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_melitensis_I                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:162 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-18.40 kcal/mol Antiterminator: Size=69 nt.     Delta G=-10.40 kcal/mol Anti-antiterminator:   Size=15 nt.     Delta G= -6.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case cctcgcctttgccatgatgcgtgttatcttgttgcgggataaaaatgcgatacacgccagaaaggccagatgacggatcatagcaacgacaggaaagaca ggccgcgcgccgcgcggggcgcctttctgcggcttttttccggggaaggcgctgctctgcgccggctacatctgcgcacctttctctccatcgccatcga gcggctctggccgctcgtgctgccgctgattctgcttcttgcgctgtttgcaagcctgggctggcttggtctttttgcgctgatgccacgctggctgcat ATG     BMEI0083 Gene: BMEI0083     GI: 17986367     BI number: BMEI0083     GOG: NOG14524     Description: Hypothetical Protei            gg           c  a            at            gc            ta            at           |  a           |  g           |  c           |  a           |  a           |  c           |  g           |  a           |  c           |  a           |  g           |  g           |  a           |  a           |  a           |  g           |  a           g  c           a  a            cg            cg        gc            gc       c  g            gc       g  g           a  g       cg           a  c       cg           a  |       gc           g  |       cg           a  |       gc           c  |      |  c            cg       |  t            gc       |  t            cg       |  t   a       a  c      |  c t  c      c  c      |  t a  a      a  g       cg gc       t  |       gc cg       a  |       cg gc        gc        cg Gc        cg        gc Ta        gc        gt                         tttttccggggaaggcgctgctctgcgccggctacatctgcgcacctttctctccatcgccatcgagcggctctggccgctcgtgctgccgctgattctgcttcttgcgctgtttgcaagcctgggctggcttggtctttttgcgctgatgccacgctggctgcatATG     ..................................................................................................................