                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:114 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -6.10 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-10.40 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -8.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTACTGCCGTGTTGGCGAATTCCCTGGTGCCCAGAAAGCTTGCAAGCGAGGTGGCGA
AAATCAGAAATGGAAACAGCGCCATCAGGCCCGAAAGGGCAATGTGGCTGGCAAAAGC
CCAGCCGTCGTCGGTGCTGAAATGTCCCCATACATCGAAGGTGATCTGACGGAGAAAA
CGTCTGATTTTTTGCATccgtagattggccctcgcgattgacttttcctgcctgacgaatttgcaactgtagtgctaaatctagcatc
ggagtagagattgcaagggcggcggcgttttaaagagaGTG

    BMEI0090 Gene: BMEI0090     GI: 17986374     BI number: BMEI0090     GOG: COG1028     Description: SHORT-CHAIN DEHYDROGENAS            CC           C  A           C  T            TA CG        GC T  T       TA GC        AT CG       |  C CG       A  G GT       A  A A  |      G  A C  |       TG C  |       CG         A CG        GT       G  A GC       |  G      A  A AT       |  A      G  A |  G      T  T       GC |  A       GC        CG A  A       GT        AT A  A       CG        GC AT        TA       T  T CG        GC        CG GT        CG        TA GC        TG        AT                         TTTTTGCATccgtagattggccctcgcgattgacttttcctgcctgacgaatttgcaactgtagtgctaaatctagcatcggagtagagattgcaagggcggcggcgttttaaagagaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here     ..................................................................................................................