                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:71 nt.     Distance to run of Ts=2 nt.   Size=27 nt.     Delta G= -8.46 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -7.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gaatgcggcggaatttggcccggatatgccctgtattgtaacaaccgacaggttttccagcctcagatgtggcgaatccgaaattcgcaTCACTTT
GAAGCAACGTTGACATCGCTCCAAGCCCCTCTCATCTGTCCTTCGGCTTTGCGTCCAG
TAAGTGGCGGGGAAAATTGTGTCTTGAAAGCGCCGGAACTGGCTGCTTTACGGTGCAC
TTTTCTTGCAATTGTTTCAATACGCGTGAATAAAGCATTCGACATTGCCGGAAGCGCT
TCCGGCTGAACGGACAGGAAAGGACCAGAGATG

    BMEI0121 Gene: BMEI0121     GI: 17986405     BI number: BMEI0121     GOG: COG0653     Description: PROTEIN TRANSLOCASE, SUBUNIT SEC AA G  A G  A GT GT CG GT G  G        C T  T      G  T GC       G  G AT       T  C AT       C  T TG       A  T G  A      A  T A  A      G  A C  A       GC C  |       CG TG        CG GC        GT CG        CG GC        GC             ACTTTTCTTGCAATTGTTTCAATACGCGTGAATAAAGCATTCGACATTGCCGGAAGCGCTTCCGGCTGAACGGACAGGAAAGGACCAGAGATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG0653 Preprotein translocase subunit SecA (ATPase, RNA helicase) ... can be seen here     ..................................................................................................................