                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:122 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -9.60 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -9.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ccggatggatggcctttatctttcgggtgctaaaatgacttgcgccctgccgcatcgagccgcttgagcaggggaccgctccgctctttgcgtctttttg
gcatgtcttgttatttcagatgccatttcgatcaaatgaacagatcgcgaccctgcggcattatccggggcgtttttcttgtcaggctgcgtttcccgct
tgattttatgcagcaaacctttccaatgcgcggatcaggcttttgaatccgcaaatcgggtttgccacactggaaacatcctatcgctttcgaggcacat
ATG

    BMEI0124 Gene: BMEI0124     GI: 17986408     BI number: BMEI0124     GOG: COG1364     Description: GLUTAMATE N-ACETYLTRANSFERASE / AMINO-ACID ACETYLTRANSFERAS at t  t t  t        g gc       t  a ta       a  a tg       a  c c  |      a  a t  |       cg g  |       ta ta        at at        gc cg        cg gc       t  c        t gc        tg       a  t ta        ta       c  a t  t      |  c       gt t  t      |  c       gc t  t      |  c      c  | t  c      |  t       gc cg       |  g       tg ta       a  c       cg gt        cg        cg c  |       cg        cg gc        gc       a  | ta        ta        gc ta        at        cg ta        gt        gt                         ttttcttgtcaggctgcgtttcccgcttgattttatgcagcaaacctttccaatgcgcggatcaggcttttgaatccgcaaatcgggtttgccacactggaaacatcctatcgctttcgaggcacatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1364 N-acetylglutamate synthase (N-acetylornithine aminotransferase) ... can be seen here     ..................................................................................................................