                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=3 nt.   Size=30 nt.     Delta G=-15.20 kcal/mol
Antiterminator: Size=12 nt.     Delta G= -3.30 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-16.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCCTGACAATTCGGCGCTGAAAGAACGGGCGAAGGAAATTGCCCGCCTGCGCGCGCA
CGAGCGGATGACGCTGCCATCCACCATCGCGCTCGAAATGGCCACCAATCCATTCCTG
CGCTGGCATGACCGCACCATTCGCGCGCGCCTCGGCCTGCAGGATGCGCCAGACGAAG
CCGTGTTTGCGGAAATCCGCAAGCGAAAGGATATGTTTTGAacacacttcccacgccttatgaagctttg
atttcaaggaccaggagatgacggcaatatcccgtttcaagatcacaagccgcgctGTG

    BMEI0128 Gene: BMEI0128     GI: 17986412     BI number: BMEI0128     GOG: -------     Description: Hypothetical Protei CC G  T G  G C  C TA CG CG |  A GT CG GC CG GC                  AA |  C                A  T |  A                 GC |  G                 GC C  A                 CG GC                  GC CG                  TA TA                  TA TA                  TG |  G                 GC A  C       TT        TG C  C      G  T      |  A CG        TG       |  A AT        GC       G  A CG        CG        CG GT        CG        CG                         ATATGTTTTGAacacacttcccacgccttatgaagctttgatttcaaggaccaggagatgacggcaatatcccgtttcaagatcacaagccgcgctGTG     ..................................................................................................................