Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:156 nt.     Distance to run of Ts=3 nt.   Size=33 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-20.40 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-16.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gcagggcctgcttgcggcttgcggatgggggcgttcccgtgttgcaagactgacaggattgacggcttgccggccgcttcgccacaggcgggttgcggag
ggcaggaagtggcatttttgcttccaaaatgctggattttcttacgtttacgtaagagcctgtaaatctaaccgattgaaaacattggtcgcaaaataat
gagttgagtttatcttcaaagagtcctatctcgcaggtccaacgcttgagtgttttccggggaggaaaccggatgggcttgatgcgtctctggatcaaat
TTG

    BMEI0137


Gene: BMEI0137     GI: 17986421     BI number: BMEI0137     GOG: COG0039     Description: MALATE DEHYDROGENAS


 ga
g  t
 at
 cg
a  a
 gc
 tg
 cg
a  |        c
 gc       a  a
 at        cg         t
 at        cg       a  t
 cg        gc       c  t
|  c       cg        gt
 gc        tg        gt
 tg       |  g       tg
 tg       |  t       gc
 gc       t  t       at
t  |       cg        at
 gc        gc        gc
 cg        cg        gc
c  c       cg       |  a
c  t      g  a      |  a
t  t      g  g      |  a
t  |       cg       |  a
 gc        cg        at
 cg        gc        cg
 gc        ta        gc
 gc        tg        gt
                        ggattttcttacgtttacgtaagagcctgtaaatctaaccgattgaaaacattggtcgcaaaataatgagttgagtttatcttcaaagagtcctatctcgcaggtccaacgcttgagtgttttccggggaggaaaccggatgggcttgatgcgtctctggatcaaatTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG0039 Malate/lactate dehydrogenases ... can be seen here

    ..................................................................................................................