                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:160 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-17.70 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-11.90 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G=-15.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAAAGAAAGACAACCGCACCAAGGCCGAGCGCGCAGCAGACAAGCTTGCCGCTGCCA
AGGCCGAGGCTGCCAAGACGGCTGCTGAATAAgattcacacaagcgattttcaaaaggcggcctctggccgccttt
tttattttccaaaccgaaagcgtggtgtaatatcaggcataaaactgcccgctttctgaaagattattactgcgataccctgttgcggtttctgtttctt
gacgaaaagcggtggcaggtgcatatgacagcctggaattaagaaccgttcaaaggaaccctcgcaATG

    BMEI0157 Gene: BMEI0157     GI: 17986441     BI number: BMEI0157     GOG: COG0065     Description: 3-ISOPROPYLMALATE DEHYDRATASE LARGE SUBUNI GA        ca C  G      a  a CG       c  g GC       a  c GT        cg A  G       ta A  C      t  t C  C       at C  A       gt G  |       At         c TA       A  c      t  t CG       T  a       cg |  A      A  a       cg GC       A  a       gc CG       G  a       gc CG        Tg        cg GC        Cg        gc T  T       Gc        gc T  |       Tg        at CG        Cg        at GC        Gc        at AT        Gc        at                         ttattttccaaaccgaaagcgtggtgtaatatcaggcataaaactgcccgctttctgaaagattattactgcgataccctgttgcggtttctgtttcttgacgaaaagcggtggcaggtgcatatgacagcctggaattaagaaccgttcaaaggaaccctcgcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0065 3-isopropylmalate dehydratase large subunit ... can be seen here     ..................................................................................................................