                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:204 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-13.70 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -8.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGCAATTGCCGGTCACTTCGTCGATATTCGCGCGTGGAAGTGAgcacaaccccgcataaagtttga
aaagaccgccggttgatcccggcggtcttttcgttttccgtcacgacagatcggtcgcacatatatcttaacgaggcgctttacctgtatcgtccgcgct
ggctacaatcgccttgcaccgcttacccgatttggcttgccgtgcctgattttctcgggcgcgcaaggccggggcgatcggggtggttgcagcgttctgt
tcccataaaaacgccctaacaaggaaacgttgaATG

    BMEI0158 Gene: BMEI0158     GI: 17986442     BI number: BMEI0158     GOG: COG0454     Description: ACETYLTRANSFERAS   T T  C A  G T  C A  G GC CG T  T       aa G  G      g  a CG        ta TA        tg TA        ta CG        gc AT       a  c CG       a  | TA       a  | |  g      t  | |  c      a  |       ga |  a       cg       t  t |  c       gc       t  c |  a      c  c       gc |  a      c  |       gc |  c       cg        cg |  c       cg        cg Gc        at        gc Gc        at        cg Cg        cg        cg                         tcttttcgttttccgtcacgacagatcggtcgcacatatatcttaacgaggcgctttacctgtatcgtccgcgctggctacaatcgccttgcaccgcttacccgatttggcttgccgtgcctgattttctcgggcgcgcaaggccggggcgatcggggtggttgcagcgttctgttcccataaaaacgccctaacaaggaaacgttgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KR] COG0454 Histone acetyltransferase HPA2 and related acetyltransferases ... can be seen here     ..................................................................................................................