                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:185 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-12.90 kcal/mol
Antiterminator: Size=19 nt.     Delta G= -6.00 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-24.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATCGCCTTGCATGGGGAGGCGGTGCAGTGAgaacgggagtaggggagtaggaaggtgtttccctgcttccccggct
ttcgcaaggtgctggcgaaccttgcgccttttctttatttgccgggccttatgcatggttaatgaggaattaactatccggcgattaggatcggaccgat
tcagtgcgccccgagcatgtccgctcacgggccagcaaaaatattcggttcgggacaggctttatgcggcaaggatattcgccctcatacccgctgcgtg
acgagcggattacggaagacaggTTG

    BMEI0168 Gene: BMEI0168     GI: 17986452     BI number: BMEI0168     GOG: COG1674     Description: CELL DIVISION PROTEIN FTS aa g  g g  g at tg gt at gt gc gc gc at                  gg tg                 t  c gc                 c  g at                 g  a |  t                 ta |  c                 gc gc                  gc gc                  at gc        ca        at cg       g  a       cg |  g       cg        gc a  c       tg       c  | at       t  t      t  | gt       t  |      t  | At        cg       t  | Gc        gc        cg Tg        gt        gc Gc        cg        gc                         ttttctttatttgccgggccttatgcatggttaatgaggaattaactatccggcgattaggatcggaccgattcagtgcgccccgagcatgtccgctcacgggccagcaaaaatattcggttcgggacaggctttatgcggcaaggatattcgccctcatacccgctgcgtgacgagcggattacggaagacaggTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG1674 DNA segregation ATPase FtsK/SpoIIIE and related proteins ... can be seen here     ..................................................................................................................