                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:54 nt.     Distance to run of Ts=1 nt.   Size=23 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-15.50 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -5.56 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGAGGCCGGGGCCAGCCGTAGCGGCCACTGCATCCACCTCGTACAGTTTCAGGCCCG
CGTCGTTCAGGGCACGGTCCACCAGCCTGTCCAATGCCTCGACATGGGCGCGGGCGGC
GATCTCCGGCACCACGCCGCCATAGGGCTCGTGCTCGGCAATCTGGCTCAGAACCACA
TTGGACAAAATCCGCCCTTCGCCCATATCGTCACGCTCGACGATTGCGGCGGCTGTTT
CGTCGCAACTTGTTTCTATTCCAAGAACGCGCATttgcggttagaccctgcctggctcatattggcgcATG

    BMEI0176 --- BMEI0177 Gene: BMEI0176     GI: 17986460     BI number: BMEI0176     GOG: COG0181     Description: PORPHOBILINOGEN DEAMINASE Gene: BMEI0177     GI: 17986461     BI number: BMEI0177     GOG: COG1587     Description: UROPORPHYRINOGEN-III SYNTHAS   A C  T       GC A  T      C  T CG       A  C CG        CG |  A       TA |  C       GC |  A       CG A  A       TA A  A       AT G  A      T  T A  T      A  | C  C      C  | T  C      C  |        G CG        CG       T  T GC        GC       C  T GC       C  |       GT T  C      T  |       GC C  T      T  |       CG T  T      C  |       GT A  C       CG        GC A  |       CG        CG CG        GC        GC GC        CG        TA GC        CG        TA                         CTTGTTTCTATTCCAAGAACGCGCATttgcggttagaccctgcctggctcatattggcgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0181 Porphobilinogen deaminase ... can be seen here [H] COG1587 Uroporphyrinogen-III synthase ... can be seen here     ..................................................................................................................