                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:25 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-15.70 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-10.14 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCCGATGGAGTTGCCCCCATGCCGCATTTCGAGTGCGGTGCTTTCAACCACTCAGCCA
CCTCTCCgcgttatgcagcactgtaaaacgacccttgaagaatcgcacagtaacgagcatcaaaaagcgaatgccgagtgtgcagcggctcaata
acgagcctgcgccgtttagacaagagctaatttgcattccgttgtgaaaattcttgacttttccgccgcttcaaacctataagcaccagaccttgggcgt
ggggtgatccgcgcctattgttttggttgcggatttccgggttcccgGTG

    BMEI0201 Gene: BMEI0201     GI: 17986485     BI number: BMEI0201     GOG: COG0261     Description: LSU ribosomal protein L21 cc a  a c  g g  a a  c a  c t  t at tg        tg cg       g  a cg        gt a  c       gc a  g       gc at        tg cg        gc tg        cg tg        gc cg        gc gt        gt cg        ta             ttgttttggttgcggatttccgggttcccgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0261 Ribosomal protein L21 ... can be seen here     ..................................................................................................................