                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:116 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-17.70 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-24.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTAAACGGCTCCGTGTCTTTCCGTACGAAAGCCAACGGCCGCACGTATGTATCGGTCA
ACCCGATCGCGGAAGCAGCAGAGTAAgccgggcactctcataaagcaccggcgtcccatcggacccggtgcaaatggcagc
ctcgccaaaagatcgaagggaagatgggtcaccatcttccctttttgcatctggaggaacaaaaaatggttgtcgaagaagaaagctacgaagcaagttg
ttgtaagcgggaagcggattatgccgatgcatctcccggcttggaaaaggagctgggctatGTG

    BMEI0203 Gene: BMEI0203     GI: 17986487     BI number: BMEI0203     GOG: COG1670     Description: ACETYLTRANSFERAS at c  c cg cg ta gc c  | gc gc        cc cg       g  t cg       a  c at        cg cg        gc gc        gc a  a       ta a  a      |  a a  |      |  a       tc ta       a  a      g  a at       a  g       gc cg       a  a       gc tg       c  t       ta c  c       gc        at t  a       tg        gc c  |      g  a       at a  |      g  a       at cg        cg        gc gc        cg        gc gc        cg        gc                         tttttgcatctggaggaacaaaaaatggttgtcgaagaagaaagctacgaagcaagttgttgtaagcgggaagcggattatgccgatgcatctcccggcttggaaaaggagctgggctatGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1670 Acetyltransferases, including N-acetylases of ribosomal proteins ... can be seen here     ..................................................................................................................