                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:123 nt.    Distance to gene:90 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G=-11.10 kcal/mol
Antiterminator:    Distance from promoter:112 nt. Size=29 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:    Distance from promoter:96 nt.    Size=28 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgacc-tagaat. It has a score value of 70.28 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacctaaaatataacaaaaagttaatagaatatacaattgttgagtactgagtttatcttattaggtatttaaatgtctttttttaaaaaaaatatat
cgataacagccatgggtggcttgatgttgtcgcttgcagtcgacgctgcgaaggcggaggaaaatgtttcgcaggtgaaacttcctcctgtttttgtttt
tgagcttgttgaaaaccaggggctggccaatattgctctgattcgacctcgagtgatagcgccagacaacaacctacgtcctgggggcattGTG

    BMEI0205 Gene: BMEI0205     GI: 17986489     BI number: BMEI0205     GOG: -------     Description: IMMUNOGLOBULIN-BINDING PROTEIN EIB                      ag                     c  g ga        ga        gt c  c      g  a       cg tg       a  a       ta gc       g  a       ta at        gt        ta cg        cg        gc gc       g  |      t  | tg        gt       a  | |  a       at       a  | |  a       at        at tg        gc        at cg        cg        gc gc        gc        gc cg        ta        at tg        cg        gc                         ctgtttttgtttttgagcttgttgaaaaccaggggctggccaatattgctctgattcgacctcgagtgatagcgccagacaacaacctacgtcctgggggcattGTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_melitensis_I                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:122 nt.    Distance to gene:98 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-14.40 kcal/mol Antiterminator:    Distance from promoter:92 nt. Size=29 nt.     Delta G= -9.30 kcal/mol Anti-antiterminator:    Distance from promoter:67 nt.    Size=32 nt.     Delta G=-12.10 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgacc-tagaat. It has a score value of 70.28 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgacctaaaatataacaaaaagttaatagaatatacaattgttgagtactgagtttatcttattaggtatttaaatgtctttttttaaaaaaaatatat cgataacagccatgggtggcttgatgttgtcgcttgcagtcgacgctgcgaaggcggaggaaaatgtttcgcaggtgaaacttcctcctgtttttgtttt tgagcttgttgaaaaccaggggctggccaatattgctctgattcgacctcgagtgatagcgccagacaacaacctacgtcctgggggcattGTG     BMEI0205 Gene: BMEI0205     GI: 17986489     BI number: BMEI0205     GOG: -------     Description: IMMUNOGLOBULIN-BINDING PROTEIN EIB gg                  ag t  g                c  g at                  gt cg        tc        cg cg       g  g       ta gc       a  a       ta |  t      c  c       ta |  t       gg        gc |  g       tc       t  | |  a      t  |      a  | at        ct       a  | cg        gg        at at        cc        at at        tg        gc tg        ga        gc at        ta        at gc        tg        gc cg        gg        gc                         tgtttttgtttttgagcttgttgaaaaccaggggctggccaatattgctctgattcgacctcgagtgatagcgccagacaacaacctacgtcctgggggcattGTG     ..................................................................................................................