                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:109 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-22.70 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-14.02 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCACCGCTTTGGCTGCTGGTATCGGTTACACAAGCAAGAACGAAAACGCTCGTTATA
ACGTGAGTGTAGCTTACAACGAAGCTGGCACATCCTGGAATGCAGGTGCAAGCTTTAC
GCTTAACTAAtagctgcgcaaaattgcatggcataatatgcacccggagatatctcttcgggtgcataattttttctaggccgcctcaggtgg
aggcagagaattcccttgaaaatgaattgtccgctctgcaactgcttgcaggaaacgggttttgctgtaattgcaacgtcacatgcgggcaTTG

    BMEI0206 --- BMEI0207 --- BMEI0208 --- BMEI0209 Gene: BMEI0206     GI: 17986490     BI number: BMEI0206     GOG: COG0536     Description: GTP-BINDING PROTEIN Gene: BMEI0207     GI: 17986491     BI number: BMEI0207     GOG: COG0263     Description: GLUTAMATE 5-KINASE Gene: BMEI0208     GI: 17986492     BI number: BMEI0208     GOG: COG0014     Description: GAMMA-GLUTAMYL PHOSPHATE REDUCTASE (GPR) Gene: BMEI0209     GI: 17986493     BI number: BMEI0209     GOG: COG1057     Description: NICOTINATE-NUCLEOTIDE ADENYLYLTRANSFERASE / NICOTINAMIDE-NUCLEOTIDE ADENYLYLTRANSFERAS   A T  A C  t A  a A  g       at T  c      c  a T  t      g  a Cg        gt Gc        ta Cg        at A  c       cg Ta        gc Ta        ta        at Ta       t  c      t  c C  a      a  c       at G  |      a  |       gc At       a  |       at At       a  |       gt Cg       c  |       gc Gc        gc        cg Ta        cg        cg Gt       g  g       cg G  g       ta        at A  |       cg        cg Cg       g  a       gc Gc        at        ta Ta        ta        at At        At        ta                         attttttctaggccgcctcaggtggaggcagagaattcccttgaaaatgaattgtccgctctgcaactgcttgcaggaaacgggttttgctgtaattgcaacgtcacatgcgggcaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0536 Predicted GTPase ... can be seen here [E] COG0263 Glutamate 5-kinase ... can be seen here [E] COG0014 Gamma-glutamyl phosphate reductase ... can be seen here [H] COG1057 Nicotinic acid mononucleotide adenylyltransferase ... can be seen here     ..................................................................................................................