                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:16 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G=-20.20 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -9.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATTTCTTTTCGTAGGGCTCGTTGCCGGCTGGCTGGCGGGCAAGGTTGTGCAGGGCGG
CGGCTTCGGCCTGATCGGCAATATCATCGTCGGCGTGATCGGCGCTTTCTTTGCGGGC
TGGCTGTTGCCGCGCCTCGGCTTTTCGGTCGGCGGCGGGGTTATTGCTTCGATCATCA
ACGCCTTTATCGGCGCGGCCATACTCCTTATCATTTTGCGCATCGTCAAACGCGCTTG
AactggaaccgtcctgacaggcccggcgctccggtgccgggtcgtgctgttttcaaagtcgtggggacATG

    BMEI0217 Gene: BMEI0217     GI: 17986501     BI number: BMEI0217     GOG: COG3619     Description: Hypothetical Protei            cc           a  g TC        at G  A       gc C  A       gc T  A      t  t A  C      c  g CG       a  a GC       A  | CG        Gc        cc GC        Ta       t  g T  T       Tg        cg T  |       Cg        gt T  |       Gc        cg T  |      C  c       gc AT        Gc        gc CG        Cg        cg TA       A  |       cg A  a      A  |       cg T  c      A  |       gt T  t      C  |       gc Cg        Tg       |  g Cg        Gc        at Ta        Cg        cg                         ctgttttcaaagtcgtggggacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3619 Predicted membrane protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_melitensis_I                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:192 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-11.62 kcal/mol Antiterminator: Size=46 nt.     Delta G=-19.80 kcal/mol Anti-antiterminator:   Size=35 nt.     Delta G=-12.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TATTTCTTTTCGTAGGGCTCGTTGCCGGCTGGCTGGCGGGCAAGGTTGTGCAGGGCGG CGGCTTCGGCCTGATCGGCAATATCATCGTCGGCGTGATCGGCGCTTTCTTTGCGGGC TGGCTGTTGCCGCGCCTCGGCTTTTCGGTCGGCGGCGGGGTTATTGCTTCGATCATCA ACGCCTTTATCGGCGCGGCCATACTCCTTATCATTTTGCGCATCGTCAAACGCGCTTG AactggaaccgtcctgacaggcccggcgctccggtgccgggtcgtgctgttttcaaagtcgtggggacATG     BMEI0217 Gene: BMEI0217     GI: 17986501     BI number: BMEI0217     GOG: COG3619     Description: Hypothetical Protei             G           A  G            CG            GC           |  G        A            TG       C  T            GC       T  C gg        TG       A  G g  a       TG       T  T gc        GC       A  C tA        GT       A  G gT        AT        CG cG       |  C       GC tG       A  G      |  G gC        CG        GT aT        GC        CG a  G       GC        TA a  G       GT        AT c  C       CG        GC t  |      |  A       TG tG        GT        CG tG        GC       |  C tG        TG        CG gC        CG        GC tA        GC        GT                         TTCTTTGCGGGCTGGCTGTTGCCGCGCCTCGGCTTTTCGGTCGGCGGCGGGGTTATTGCTTCGATCATCAACGCCTTTATCGGCGCGGCCATACTCCTTATCATTTTGCGCATCGTCAAACGCGCTTGAactggaaccgtcctgacaggcccggcgctccggtgccgggtcgtgctgttttcaaagtcgtggggacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3619 Predicted membrane protein ... can be seen here     ..................................................................................................................