                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:214 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -5.72 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCAACGAACTGGACGATCATCTGATCAAACTTTGAggcccaggttcaccgcaaaatgtggcggggtgaattg
ttttttgcctttttgcgcatggtgattttccagatgtggagaaatactccggtatattctgaaatttcaggctaaattttcgtagtaatctttcaaattg
agcggatcagatgcttcttttctgacttttcgggaaaattttcgttatcttcagtgaattaggatcgaatcccatggctaatctgctaatttggcgcgca
ttgccataatgacagggagtatccggcGTG

    BMEI0231 Gene: BMEI0231     GI: 17986515     BI number: BMEI0231     GOG: COG2902     Description: NAD-SPECIFIC GLUTAMATE DEHYDROGENAS             C           T  A           A  A   G       G  A T  G      T  C G  A      C  T c  A      T  T       at gC        AT       a  g gT        CG       a  t cG        TA       a  g cG       A  g       cg tA       G  g       gc a  C      C  c      |  g t  G      A  |      |  g g  A       Gc        cg aT        Gc        cg gC        Ta        at |  A      |  g       cg gT        Cg        ta gC        At        ta aT        At        gt cG        Gc        gt                         gttttttgcctttttgcgcatggtgattttccagatgtggagaaatactccggtatattctgaaatttcaggctaaattttcgtagtaatctttcaaattgagcggatcagatgcttcttttctgacttttcgggaaaattttcgttatcttcagtgaattaggatcgaatcccatggctaatctgctaatttggcgcgcattgccataatgacagggagtatccggcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG2902 NAD-specific glutamate dehydrogenase ... can be seen here     ..................................................................................................................