                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:82 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-18.50 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-23.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCGCCAAGGAGAAGGACCCAGCAGCGGCATGGCTTGCCGCGGATGGCGCCCGTATCG
AACAGGTGAAAAATCGCATGGTGGCGCTGACGGAGGGAGGGGATCTGACCGTTTCCCG
CCTTGCGGTTGCGGCGGGTCTTATGTCCGATCTGGCGCAATAAtcacgcccggccttgaaagaatgaa
aagggtggctctcgcgctacccttttctgtttttgtatcgtcaatataggcaatataagaatcgtttgtttgagacgcttttgggatgagttgacaatta
ttcataaaatgcttgcGTG

    BMEI0232 Gene: BMEI0232     GI: 17986516     BI number: BMEI0232     GOG: COG2270     Description: TRANSPORTE TG A  T T  C T  C CG TA GT GC GT CG G  G GC CG GC TA TA                  tc GT         a       c  g |  A      g  a      t  c |  A      a  t       cg |  t      a  g       gc |  c      a  a       gt |  a      g  a       ta Gc        ta        gc Cg        ta        gc Gc        cg        gc T  c       cg        at T  c      g  g       at Cg        gt        at Cg        cg        at Gc        cg        gc                         tgtttttgtatcgtcaatataggcaatataagaatcgtttgtttgagacgcttttgggatgagttgacaattattcataaaatgcttgcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2270 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_melitensis_I                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:90 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-11.30 kcal/mol Antiterminator: Size=27 nt.     Delta G= -6.80 kcal/mol Anti-antiterminator:   Size=73 nt.     Delta G=-34.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTCGCCAAGGAGAAGGACCCAGCAGCGGCATGGCTTGCCGCGGATGGCGCCCGTATCG AACAGGTGAAAAATCGCATGGTGGCGCTGACGGAGGGAGGGGATCTGACCGTTTCCCG CCTTGCGGTTGCGGCGGGTCTTATGTCCGATCTGGCGCAATAAtcacgcccggccttgaaagaatgaa aagggtggctctcgcgctacccttttctgtttttgtatcgtcaatataggcaatataagaatcgtttgtttgagacgcttttgggatgagttgacaatta ttcataaaatgcttgcGTG     BMEI0232 Gene: BMEI0232     GI: 17986516     BI number: BMEI0232     GOG: COG2270     Description: TRANSPORTE   T C  T CG GC CG CG C  T T  T T  | TG GC CG CG A  | GC TG CG TG AT GC GT GT G  A A  T G  G G  | G  |        c AT       t  a GC       A  c GC       A  g CG       T  c       tc |  A      A  c      c  g AT        Ac       t  c GC        Cg        cg |  T       Gg        gc TG        Cc        gt CG       G  c       ta GC        Gt        gc CG        Tt        gc GC        Cg        gc                         ttttctgtttttgtatcgtcaatataggcaatataagaatcgtttgtttgagacgcttttgggatgagttgacaattattcataaaatgcttgcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2270 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................