                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:155 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-15.20 kcal/mol
Antiterminator: Size=58 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G= -9.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAagcggacgtcgtcatggcgatttccccttttttgtgaagagcctcattgccaggcccctgattttgagataatcgctccaattagtttttaaagagt
aaaaacaatatgttagcagcatccatattggattgctgctattttttccctttacgatgcggcaataagcgaacgccaggcgcgccaattgtctaattta
ccttgccttcgagggacgatagacaggtcatgtgacggtctttggcgctttgcgtcggggccgcttcatccggctggaggaagccgggcaatttgttttg
gGTG

    BMEI0238 Gene: BMEI0238     GI: 17986522     BI number: BMEI0238     GOG: COG0365     Description: ACETYL-COENZYME A SYNTHETAS             g           a  a           a  g            at            ta            ta            ta            ta            ta cc        gc g  c      a  | gc        ta at        ta cg        at c  a      |  a g  t       at t  t       cg t  t      |  t        a at       c  t      t  t cg        ta       a  t ta        cg        cg cg        gc        cg |  a      c  a       ta |  t      t  g      |  t |  a      a  c       at |  a      a  |       cg |  t       ta        gc |  c       at        at cg        gc        cg gc       a  |       gc at        gc        at gc        ta        ta                         ttttttccctttacgatgcggcaataagcgaacgccaggcgcgccaattgtctaatttaccttgccttcgagggacgatagacaggtcatgtgacggtctttggcgctttgcgtcggggccgcttcatccggctggaggaagccgggcaatttgttttggGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0365 Acyl-coenzyme A synthetases/AMP-(fatty) acid ligases ... can be seen here     ..................................................................................................................