                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:102 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-18.00 kcal/mol
Antiterminator: Size=24 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTTTGGGGGCACGCTTTTGTCGCTCCACTATTATCTGGTGGACACGATCGTGCTGAT
GATTATCGGCACGGTGGGCTTTCGCTATACGCGCACCAAGCAGATGGTGCGCCAGTAT
AGCTGGCTCTACGAAAAAACCTCTCCATTCGGCTGGAAGGCGAAATAAtttaaagcttcgccgt
tatgcggcggagcttttttaaaagatcacgttgataataataagattcaacgtagatattgtcgattaatcgacaagataataaggcgatgcgaaaacat
cgcttcggggtaaacaaaatTTG

    BMEI0263 Gene: BMEI0263     GI: 17986547     BI number: BMEI0263     GOG: COG0683     Description: LEUCINE-, ISOLEUCINE-, VALINE-, THREONINE-, AND ALANINE-BINDING PROTEIN PRECURSO             a tt       t  t t  a      t  g A  a       gc A  a       cg T  g       cg A  c       gc At        cg At        tg Gc        ta Cg        cg Gc        gc Gc        at             tttttaaaagatcacgttgataataataagattcaacgtagatattgtcgattaatcgacaagataataaggcgatgcgaaaacatcgcttcggggtaaacaaaatTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0683 ABC-type branched-chain amino acid transport systems, periplasmic component ... can be seen here     ..................................................................................................................