Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:191 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-18.90 kcal/mol
Antiterminator: Size=61 nt.     Delta G=-12.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGAAGACGGCAAGTATAATTACTTCCAGAAGTAAattgcctgatatattagcaaaaaatgctacaaaattcag
caatctgcccggcttttagccgggcattttgtttttaacttcccgtcgcacagtttgtttgcgcttcggccagttgccatgtaatcaaagctgcctttgt
cattgcagttagagcggtttcggttaaaacggaatcgttggaaccgttctatttctttgtttttacgcattatctgacgcaaaaccgcttcgcatttttg
ctggaaatgcactagggagatctgccTTG

    BMEI0266


Gene: BMEI0266     GI: 17986550     BI number: BMEI0266     GOG: COG1038     Description: PYRUVATE CARBOXYLAS


  a
a  a
a  a
 at
 cg
 gc
 at
 ta
|  c
t  a
a  a
t  a
a  a
t  t
 at
 gc
 ta
c  |        t
 cg       t  t
 gc       t  a
 ta        cg
 ta        gc
 at        gc
A  c       cg
 At        cg
 Tg        cg
 Gc        gc
A  c       ta
A  c      c  t
G  |      t  t
A  |       at
 Cg        at
 Cg        cg
            tttttaacttcccgtcgcacagtttgtttgcgcttcggccagttgccatgtaatcaaagctgcctttgtcattgcagttagagcggtttcggttaaaacggaatcgttggaaccgttctatttctttgtttttacgcattatctgacgcaaaaccgcttcgcatttttgctggaaatgcactagggagatctgccTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG1038 Pyruvate carboxylase ... can be seen here

    ..................................................................................................................