                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:111 nt.     Distance to run of Ts=2 nt.   Size=18 nt.     Delta G= -6.60 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -6.10 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -4.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGATGACATTCGCACCATGTTCTTCGGCAAGCATCCGGGCAAGCGCATGGTCTTCGTC
CCGGTCGGTGAAGGAGTTTATTACGACGTTATGCCCCGCGGCTGCCAGTGCATGGGCG
ATTCCGAGGCCGATCCCTGAATTTGATCCGGTAACAATTGCAGTTTTGCGGGCGGATA
CGTCGGTCATTTGTTGGTTCCTCCTTATGGCCACaccataatgagagggcgacattgcctcggcaagcgattata
taaagcgaaagccggatatacgcagacccggatctatgccagcgttgacatTTG

    BMEI0269 Gene: BMEI0269     GI: 17986553     BI number: BMEI0269     GOG: COG0821     Description: GCPE PROTEI             T           T  G           A  C           A  A            CG            AT            AT   A       |  T G  A      T  T T  T      G  G C  T       GC C  T       CG        AT CG        CG       G  A TA        TG        GC AT       A  |       CG |  C       GC        GT GC        TG        GC CG        TG       G  G CG        TA        CG GT        AT        GT                         CATTTGTTGGTTCCTCCTTATGGCCACaccataatgagagggcgacattgcctcggcaagcgattatataaagcgaaagccggatatacgcagacccggatctatgccagcgttgacatTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0821 Enzyme involved in the deoxyxylulose pathway of isoprenoid biosynthesis ... can be seen here     ..................................................................................................................