                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:79 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -9.40 kcal/mol
Antiterminator: Size=26 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -5.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCAGAGCAGCCTTGATGGCCACTGCACCCAGTTCATGAGCAGGAACATTGGCAAAGG
CGCCATTAAAGGCACCCACCGCGGTGCGCGCTGCACTGGCGATGACGATGGATTTCGG
ATCGGACATTCTTTCCTCCTTAAGCATGTGGCGCAACACaaagaccaaaaaaccggccttggcaagctccc
cgcgccgccttcatgaaaatcgagaaggtgtttttcccgccaggacaagcattcatatgggcattgccatattcaatgtctaaattgccttcaccacaat
acaggagatgaatATG

    BMEI0273 Gene: BMEI0273     GI: 17986557     BI number: BMEI0273     GOG: COG3193     Description: GLCG PROTEI aa a  a a  c a  c cg cg         c a  c      c  c gc       t  c at        cg         a at        gc       a  a a  g      a  |      a  t C  g      a  |       gc A  c       cg        tg C  a       gc       a  a A  a       gc        cg A  |      t  |       ta Cg       t  |       ta Gc       c  |       cg C  t       cg        cg Gc        gc        gt Gc        gc        cg                         tttttcccgccaggacaagcattcatatgggcattgccatattcaatgtctaaattgccttcaccacaatacaggagatgaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3193 Uncharacterized protein, possibly involved in utilization of glycolate and propanediol ... can be seen here     ..................................................................................................................