                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:7 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-12.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGAGCATGGATGCGCCATCCTGACGCTGGAAAGCCTTCACATGGCCGCCGGCATCGA
GAACGCTAACGGCAAGCGGCTTCAGTTTCAGTTCCTCGGCCTTGGCAAAAGCACCGGC
AATGATCGCGTTGGCGCGTTCGAGCGTTAGTGAAGGCATattcatctcctgtattgtggtgaaggcaattt
agacattgaatatggcaatgcccatatgaatgcttgtcctggcgggaaaaacaccttctcgattttcatgaaggcggcgcggggagcttgccaaggccgg
ttttttggtctttGTG

    BMEI0274 Gene: BMEI0274     GI: 17986558     BI number: BMEI0274     GOG: COG0183     Description: ACETYL-COA ACETYLTRANSFERAS   t t  t a  t g  c c  a t  t cg ta ta cg cg a  c c  g a  g       ga a  |      g  g a  |       gc a  |       gt a  |      c  | g  |       gt g  |       cg gc        gc cg        gc gc       |  a g  g      |  a tg       |  g cg        cg cg        gc ta        gc             ggttttttggtctttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0183 Acetyl-CoA acetyltransferase ... can be seen here     ..................................................................................................................