                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:38 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G=-10.70 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-13.90 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-13.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aaaagcccgctgatccagcgggcttttttgttgggagaacggaaattgcgcagaattttatcggattttgcaatggctcgttaactcttccgggcgtttt
ccagcattgtcagagatttatcgccgattgcgggaaccggatcggccttcatgcgttctgaaaacaccagttcgtaaacgggtttgttttgcggtgtaac
gctgttgcctctgactgacctgtgaaagagtttggggcaatatgttgcctggggcattcttttgggactggcatatccttccacttagcgtccggagggc
GTG

    BMEI0280 Gene: BMEI0280     GI: 17986563     BI number: BMEI0280     GOG: COG0568     Description: RNA POLYMERASE SIGMA-32 FACTO   a t  a gc tg gc         g gt       t  a cg       g  a gt        ta |  t       cg |  g      c  | |  c      a  | |  c      g  | |  t       ta t  c       cg        at t  t       at       t  g tg        gt        at ta       t  t       at gc        cg        cg t  t       tg        gc tg        cg        gc ta        cg        gt gc        gc       g  g gc        ta        tg gt        ta        tg cg        gt        tg at        ta        gc                         attcttttgggactggcatatccttccacttagcgtccggagggcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0568 DNA-directed RNA polymerase, sigma subunit (sigma70/sigma32) ... can be seen here     ..................................................................................................................