                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:5 nt.     Distance to run of Ts=3 nt.   Size=24 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-12.40 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-11.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGAAGTGCGGCAAGACCTGATCGCAGAACCTTCCGGCGCGAGCGAATGGGCAAAACG
GCTTGCCCCCTTGCTCGCAAGGGTCAACACGCTTGATGGAATTCACGAGATCCGCCAT
TTCGGTTCCCGGACGGATTTTGCGGGTTGAgcacccactttgcccgctatccacagggcttcacccgccaaattgagc
ctgaaacgaaaaaggcacttaattttgaccgcgactcgcgggaaaaacagtccagacattcgataggcggttttgtgccgcggcacgcccacatttttta
cagactTTG

    BMEI0289 Gene: BMEI0289     GI: 17986572     BI number: BMEI0289     GOG: COG3750     Description: Hypothetical Cytosolic Protei             a           c  t            at   c        gc a  t      |  g gc       |  a cg       a  t gc       c  a cg        cg cg        tg a  g       gc        gc g  a      a  g      c  g ta        cg        cg ta        at        gc ta        at        ta ta        at        gc a  c       at       t  | a  |      |  g      t  | t  |      a  t      t  | ta       g  g      t  | cg        gc       g  | at        gc       g  | c  |       cg        cg gc        gc        gc gc        cg        gc                         cacattttttacagactTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3750 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................