                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:156 nt.     Distance to run of Ts=2 nt.   Size=27 nt.     Delta G= -7.50 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -7.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATGCCAAGCGCACCCGTCAGCACACCGGCAAACAAcgctagagatagtggaaatcgcatccgcagaacccct
tcagcccgtcatcgctttatattggacaatttgattgcaccctgaaatctcgcatcgggttgctctcttttcggcagtttcgcctttgatgtcaacgcaa
tccgattgagaacagcctcattgacccaagaatgatcgttgcaatcccggctttctcatgacagactagaagttgctttccataaccccacagaaataag
ctcgatatcagccctggatttcgcatcATG

    BMEI0290 Gene: BMEI0290     GI: 17986573     BI number: BMEI0290     GOG: COG3931     Description: Hypothetical Cytosolic Protei             t   c       t  g t  g      a  g a  c      t  a a  a      a  c at        ta gc        ta gc       t  t tg       c  t gc        gt |  a       cg         t |  g       ta       c  c |  a       at       t  g |  a      c  t      a  c a  c       tg       a  a t  c       gc        at a  c      c  a       gc gc       c  c       tg at       c  c       cg g  t       gc        cg a  c       at       c  t ta        cg        at cg        ta        cg gc        ta        gc                         tctcttttcggcagtttcgcctttgatgtcaacgcaatccgattgagaacagcctcattgacccaagaatgatcgttgcaatcccggctttctcatgacagactagaagttgctttccataaccccacagaaataagctcgatatcagccctggatttcgcatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG3931 Predicted N-formylglutamate amidohydrolase ... can be seen here     ..................................................................................................................