                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-10.70 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-12.20 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G= -5.56 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcgtatcgggtgccatccatatcctttccaacgccagttcttgggccagttcttgatccaattcgcaggccaactccgggcatcgaatcgcacctgcggg
acgggcatctttgcaaggatagtaataatcgcccgcccgataagcaacaaatgacgggttaatgagaacgttcatacaccgttatcgttgataagaacgg
cttttcggtgtttgtttcatcctgcctgcccgacgcaatcgatttgtcgcgcacagtttatgccccaaaagccatcgatttattgactcctcatgtgcag
ATG

    BMEI0311 Gene: BMEI0311     GI: 17986594     BI number: BMEI0311     GOG: COG0021     Description: TRANSKETOLAS            ac           a  g            gt            at            gc            ta   a        at        ta a  c      a  |      a  a c  a      t  |      g  g g  a       ta        ta a  a       gc        ta a  t      |  a       gc t  g       gc        cg a  a       gc        tg gc        cg       |  c cg        at       |  t cg        gt       a  t cg        ta       t  t gt        at       t  t c  t      a  c       gc c  a      a  |       cg c  a       cg        cg gt        at        at cg        at        cg ta        cg        at                         ttgtttcatcctgcctgcccgacgcaatcgatttgtcgcgcacagtttatgccccaaaagccatcgatttattgactcctcatgtgcagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0021 Transketolase ... can be seen here     ..................................................................................................................